seq id strain atcc bacterium no 10 Search Results


by4742 genomic dna  (ATCC)
92
ATCC by4742 genomic dna
By4742 Genomic Dna, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/by4742 genomic dna/product/ATCC
Average 92 stars, based on 1 article reviews
by4742 genomic dna - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier
clostridium acetobutylicum strain atcc 824  (ATCC)
98
ATCC clostridium acetobutylicum strain atcc 824
Clostridium Acetobutylicum Strain Atcc 824, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/clostridium acetobutylicum strain atcc 824/product/ATCC
Average 98 stars, based on 1 article reviews
clostridium acetobutylicum strain atcc 824 - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier
thraustochytrium aureum atcc 34304 derived ubiquitin promoter ptracer cmv bsd lacz derived blasticidin resistant gene  (ATCC)
96
ATCC thraustochytrium aureum atcc 34304 derived ubiquitin promoter ptracer cmv bsd lacz derived blasticidin resistant gene
Thraustochytrium Aureum Atcc 34304 Derived Ubiquitin Promoter Ptracer Cmv Bsd Lacz Derived Blasticidin Resistant Gene, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/thraustochytrium aureum atcc 34304 derived ubiquitin promoter ptracer cmv bsd lacz derived blasticidin resistant gene/product/ATCC
Average 96 stars, based on 1 article reviews
thraustochytrium aureum atcc 34304 derived ubiquitin promoter ptracer cmv bsd lacz derived blasticidin resistant gene - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier
desulfovibrio desulfuricans strain g20  (ATCC)
94
ATCC desulfovibrio desulfuricans strain g20
Desulfovibrio Desulfuricans Strain G20, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/desulfovibrio desulfuricans strain g20/product/ATCC
Average 94 stars, based on 1 article reviews
desulfovibrio desulfuricans strain g20 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier
vibrio fischeri  (ATCC)
94
ATCC vibrio fischeri
Vibrio Fischeri, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vibrio fischeri/product/ATCC
Average 94 stars, based on 1 article reviews
vibrio fischeri - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier
i ditiola pezizaeformis i strain atcc13299  (ATCC)
92
ATCC i ditiola pezizaeformis i strain atcc13299
I Ditiola Pezizaeformis I Strain Atcc13299, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/i ditiola pezizaeformis i strain atcc13299/product/ATCC
Average 92 stars, based on 1 article reviews
i ditiola pezizaeformis i strain atcc13299 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier
rabbit polyclonal anti e2f1  (OriGene)
90
OriGene rabbit polyclonal anti e2f1
A) Raw RSEM RNA-Seq counts for 265 TCGA ovarian tumors. CCNE1 (cyclin E) expression was compared to <t>E2F1,</t> BRCA1 and RAD51 (Spearman correlation). B) CCNE1 copy number in CCLE ovarian cancer cell lines. C) Spearman correlation of cyclin E and E2F1 mRNA levels in CCLE cell lines most representative of serous ovarian cancer (similarity score >1) based on ref [29]. D) Western blot analysis of cyclin E and E2F1 expression in representative CCLE cell lines. Actin was the loading control.
Rabbit Polyclonal Anti E2f1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonal anti e2f1/product/OriGene
Average 90 stars, based on 1 article reviews
rabbit polyclonal anti e2f1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
strains atcc 12384  (ATCC)
95
ATCC strains atcc 12384
A) Raw RSEM RNA-Seq counts for 265 TCGA ovarian tumors. CCNE1 (cyclin E) expression was compared to <t>E2F1,</t> BRCA1 and RAD51 (Spearman correlation). B) CCNE1 copy number in CCLE ovarian cancer cell lines. C) Spearman correlation of cyclin E and E2F1 mRNA levels in CCLE cell lines most representative of serous ovarian cancer (similarity score >1) based on ref [29]. D) Western blot analysis of cyclin E and E2F1 expression in representative CCLE cell lines. Actin was the loading control.
Strains Atcc 12384, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/strains atcc 12384/product/ATCC
Average 95 stars, based on 1 article reviews
strains atcc 12384 - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier
desulfomicrobium baculatum strain dsm 4028  (ATCC)
94
ATCC desulfomicrobium baculatum strain dsm 4028
A) Raw RSEM RNA-Seq counts for 265 TCGA ovarian tumors. CCNE1 (cyclin E) expression was compared to <t>E2F1,</t> BRCA1 and RAD51 (Spearman correlation). B) CCNE1 copy number in CCLE ovarian cancer cell lines. C) Spearman correlation of cyclin E and E2F1 mRNA levels in CCLE cell lines most representative of serous ovarian cancer (similarity score >1) based on ref [29]. D) Western blot analysis of cyclin E and E2F1 expression in representative CCLE cell lines. Actin was the loading control.
Desulfomicrobium Baculatum Strain Dsm 4028, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/desulfomicrobium baculatum strain dsm 4028/product/ATCC
Average 94 stars, based on 1 article reviews
desulfomicrobium baculatum strain dsm 4028 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier
gggcatacattgttttgaagaaatcattgtggttctttatgcttattccacttcgaatgatattgaa  (ATCC)
99
ATCC gggcatacattgttttgaagaaatcattgtggttctttatgcttattccacttcgaatgatattgaa
A) Raw RSEM RNA-Seq counts for 265 TCGA ovarian tumors. CCNE1 (cyclin E) expression was compared to <t>E2F1,</t> BRCA1 and RAD51 (Spearman correlation). B) CCNE1 copy number in CCLE ovarian cancer cell lines. C) Spearman correlation of cyclin E and E2F1 mRNA levels in CCLE cell lines most representative of serous ovarian cancer (similarity score >1) based on ref [29]. D) Western blot analysis of cyclin E and E2F1 expression in representative CCLE cell lines. Actin was the loading control.
Gggcatacattgttttgaagaaatcattgtggttctttatgcttattccacttcgaatgatattgaa, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gggcatacattgttttgaagaaatcattgtggttctttatgcttattccacttcgaatgatattgaa/product/ATCC
Average 99 stars, based on 1 article reviews
gggcatacattgttttgaagaaatcattgtggttctttatgcttattccacttcgaatgatattgaa - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier
strain name strain number seq id no rhodotorula glutinis dsmz seq id  (DSMZ)
91
DSMZ strain name strain number seq id no rhodotorula glutinis dsmz seq id
A) Raw RSEM RNA-Seq counts for 265 TCGA ovarian tumors. CCNE1 (cyclin E) expression was compared to <t>E2F1,</t> BRCA1 and RAD51 (Spearman correlation). B) CCNE1 copy number in CCLE ovarian cancer cell lines. C) Spearman correlation of cyclin E and E2F1 mRNA levels in CCLE cell lines most representative of serous ovarian cancer (similarity score >1) based on ref [29]. D) Western blot analysis of cyclin E and E2F1 expression in representative CCLE cell lines. Actin was the loading control.
Strain Name Strain Number Seq Id No Rhodotorula Glutinis Dsmz Seq Id, supplied by DSMZ, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/strain name strain number seq id no rhodotorula glutinis dsmz seq id/product/DSMZ
Average 91 stars, based on 1 article reviews
strain name strain number seq id no rhodotorula glutinis dsmz seq id - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
atcc vr 594 sequence  (ATCC)
94
ATCC atcc vr 594 sequence
A) Raw RSEM RNA-Seq counts for 265 TCGA ovarian tumors. CCNE1 (cyclin E) expression was compared to <t>E2F1,</t> BRCA1 and RAD51 (Spearman correlation). B) CCNE1 copy number in CCLE ovarian cancer cell lines. C) Spearman correlation of cyclin E and E2F1 mRNA levels in CCLE cell lines most representative of serous ovarian cancer (similarity score >1) based on ref [29]. D) Western blot analysis of cyclin E and E2F1 expression in representative CCLE cell lines. Actin was the loading control.
Atcc Vr 594 Sequence, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/atcc vr 594 sequence/product/ATCC
Average 94 stars, based on 1 article reviews
atcc vr 594 sequence - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

Image Search Results


A) Raw RSEM RNA-Seq counts for 265 TCGA ovarian tumors. CCNE1 (cyclin E) expression was compared to E2F1, BRCA1 and RAD51 (Spearman correlation). B) CCNE1 copy number in CCLE ovarian cancer cell lines. C) Spearman correlation of cyclin E and E2F1 mRNA levels in CCLE cell lines most representative of serous ovarian cancer (similarity score >1) based on ref [29]. D) Western blot analysis of cyclin E and E2F1 expression in representative CCLE cell lines. Actin was the loading control.

Journal: Gynecologic oncology

Article Title: Panobinostat sensitizes cyclin E high, homologous recombination-proficient ovarian cancer to olaparib

doi: 10.1016/j.ygyno.2016.07.088

Figure Lengend Snippet: A) Raw RSEM RNA-Seq counts for 265 TCGA ovarian tumors. CCNE1 (cyclin E) expression was compared to E2F1, BRCA1 and RAD51 (Spearman correlation). B) CCNE1 copy number in CCLE ovarian cancer cell lines. C) Spearman correlation of cyclin E and E2F1 mRNA levels in CCLE cell lines most representative of serous ovarian cancer (similarity score >1) based on ref [29]. D) Western blot analysis of cyclin E and E2F1 expression in representative CCLE cell lines. Actin was the loading control.

Article Snippet: Antibodies used were rabbit polyclonal anti-cyclin E (Abcam, Cambridge, MA), rabbit polyclonal anti-E2F1 (DBA Acris Antibodies, Inc, Rockville, MD), rabbit polyclonal anti-RAD51 (Millipore), mouse monoclonal anti-BRCA1 (Millipore), rabbit polyclonal anti-PARP (Cell Signaling Technology), mouse monoclonal anti-PCNA (Santa Cruz Biotechnology, Inc., Dallas, TX), rabbit polyclonal anti-cleaved caspase-3 (Cell Signaling Technology), and mouse monoclonal anti-pH2AX (Ser139) (Millipore).

Techniques: RNA Sequencing Assay, Expressing, Western Blot

A) Concentration-dependent effects of panobinostat and vorinostat in SRB viability assays in OVCAR-3 cells (72h). Values are mean+SE of 3 independent experiments. B) Western blot analysis of the effects of panobinostat (25nM), vorinostat (5µM) and romidepsin (10nM) on expression of cyclin E1, E2F1, BRCA1, cleaved PARP and acetylated histone H3 in OVCAR-3 cells. Actin and histone H3 were loading controls. C) Effects of the panobinostat pre-treatment (25nM; 24h)/panobinostat (25nM; 24h) and olaparib (10µM) co-treatment combination regimen (24h) on cyclin E, E2F1 and BRCA1 expression in OVCAR-3 cells (24h). Actin was the loading control.

Journal: Gynecologic oncology

Article Title: Panobinostat sensitizes cyclin E high, homologous recombination-proficient ovarian cancer to olaparib

doi: 10.1016/j.ygyno.2016.07.088

Figure Lengend Snippet: A) Concentration-dependent effects of panobinostat and vorinostat in SRB viability assays in OVCAR-3 cells (72h). Values are mean+SE of 3 independent experiments. B) Western blot analysis of the effects of panobinostat (25nM), vorinostat (5µM) and romidepsin (10nM) on expression of cyclin E1, E2F1, BRCA1, cleaved PARP and acetylated histone H3 in OVCAR-3 cells. Actin and histone H3 were loading controls. C) Effects of the panobinostat pre-treatment (25nM; 24h)/panobinostat (25nM; 24h) and olaparib (10µM) co-treatment combination regimen (24h) on cyclin E, E2F1 and BRCA1 expression in OVCAR-3 cells (24h). Actin was the loading control.

Article Snippet: Antibodies used were rabbit polyclonal anti-cyclin E (Abcam, Cambridge, MA), rabbit polyclonal anti-E2F1 (DBA Acris Antibodies, Inc, Rockville, MD), rabbit polyclonal anti-RAD51 (Millipore), mouse monoclonal anti-BRCA1 (Millipore), rabbit polyclonal anti-PARP (Cell Signaling Technology), mouse monoclonal anti-PCNA (Santa Cruz Biotechnology, Inc., Dallas, TX), rabbit polyclonal anti-cleaved caspase-3 (Cell Signaling Technology), and mouse monoclonal anti-pH2AX (Ser139) (Millipore).

Techniques: Concentration Assay, Western Blot, Expressing